View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7891_low_8 (Length: 245)
Name: NF7891_low_8
Description: NF7891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7891_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 46399048 - 46398835
Alignment:
| Q |
18 |
caaattgtactctgatgtaatttaatttaatggctttgcttgtttgtgtactatggtagcctaaacctcttaggagccgaagtcctaggagcttatcaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46399048 |
caaattgtactctgatgtaatttaatttaatggctttgcttgtttgtgtactatg-tagcctgaacctcgcaggagccgaagtcctaggagcttatcaca |
46398950 |
T |
|
| Q |
118 |
atctcgttcaccttcggtatgtttactgcctctcaatcctaattcatatatgtgaatgcaaaattcttcattctacttatgttaaatctgattaacaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46398949 |
atctcgttcaccttcggtatgtttactgcctctcaatcctaattcatatatgtgaatgcaaaattcttcattctacttatgttaaatctgattaacaggt |
46398850 |
T |
|
| Q |
218 |
gagatctgaacacag |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46398849 |
gagatctgaacacag |
46398835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University