View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7892_high_6 (Length: 211)

Name: NF7892_high_6
Description: NF7892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7892_high_6
NF7892_high_6
[»] chr3 (1 HSPs)
chr3 (17-194)||(27886160-27886337)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 27886337 - 27886160
Alignment:
17 gtgttaatgatagacaatgcttgagggcaaacatcgttgtaaaaatcaggtgttagttctgcattggaatgggttgtaagaaatgtggccattaagagaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
27886337 gtgttaatgatagacaatgcttgagggcaaacatcgttgtaaaaatcaggtgttagttctgcattggaatgagttgtaagaaatgtggccattaagagaa 27886238  T
117 caatgaaataatattggatgtgatgaaaagccatttggtttgtattggctcaatctcgactatagaaaagtatttatt 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27886237 caatgaaataatattggatgtgatgaaaagccatttggtttgtattggctcaatctcgactatagaaaagtatttatt 27886160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University