View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7892_low_5 (Length: 285)
Name: NF7892_low_5
Description: NF7892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7892_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 41720141 - 41720407
Alignment:
| Q |
1 |
catcagagacaaactttagcataattcaaggactaagatttttacctgtaagaattgtatccctcttgaagcataaacagaacaaataggctctgacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720141 |
catcagagacaaactttagcataattcaaggactaagatttttacctgtaagaattgtatccctcttgaagcataaacagaacaaataggctctgacaga |
41720240 |
T |
 |
| Q |
101 |
acaaaagcagcgagatcctcgaatgtgagaccgaacatcacaacggttctcaacaccagaaacaaaaaacacgaaaacaaaccaatatcctcagaacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720241 |
acaaaagcagcgagatcctcgaatgtgagaccgaacatcacaacggttctcaacaccagaaacaaaaaacacgaaaacaaaccaatatcctcagaacaag |
41720340 |
T |
 |
| Q |
201 |
gtttcacaataaccgcaatcttacatggatccttcatcctttgtcgttgaaacctgacaatcttact |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720341 |
gtttcacaataaccgcaatcttacatggatccttcatcctttgtcgttgaaacctgacaatcttact |
41720407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University