View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_high_26 (Length: 321)
Name: NF7894_high_26
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 295
Target Start/End: Complemental strand, 28251131 - 28250849
Alignment:
| Q |
13 |
aatatctccgtcctcgaaatcacagctccaatcatcgctcccggtatcctcaccgctccaccaccttcctcctccgttaaccttaccgctttaatagaaa |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28251131 |
aatatctccgttctcgaaatcacagctccgatcatcgctcccggtatcctaaccgctccaccaccttcctcctccgttaaccttaccgctttaatagaaa |
28251032 |
T |
 |
| Q |
113 |
aagccggttgcaaaacatttgcatcccttatatcttccaacggcttaatcaaaacatttcaatcaacggctgataaaggtttaacgatttttgctccgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28251031 |
aagccggttgcaaaacatttgcatcccttatatcttccaacggcttaatcaaaacatttcaatcaacggctgataaaggtttaacgatttttgctccgaa |
28250932 |
T |
 |
| Q |
213 |
tgatgaagcttttaaagcgaaaggtgttcctgacttaaccaagctttcaaatgctgaattggtttcacttttacagtatcatg |
295 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250931 |
cgatgaagcttttaaagcgaaaggcgttccagatttaaccaagctttcaaatgctgaattggtttcacttttacagtatcatg |
28250849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University