View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_high_30 (Length: 288)
Name: NF7894_high_30
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 41620188 - 41620081
Alignment:
| Q |
1 |
aattcccatgttataaaaacaagtagtaaaaccagtttgatttgtgaactttcatagtaaacaatataagtcagtggcattcctataaccttttaaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620188 |
aattcccatgttataaaaacaagtagtaaaaccagtttgatttgtgaactttcatagtaaacaatataagtcagtggcattcctataaccttttaaaaag |
41620089 |
T |
|
| Q |
101 |
atggatta |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
41620088 |
atggatta |
41620081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 42121391 - 42121427
Alignment:
| Q |
27 |
taaaaccagtttgatttgtgaactttcatagtaaaca |
63 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
42121391 |
taaaatcagtttgattggtgaactttcatagtaaaca |
42121427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University