View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_high_41 (Length: 238)
Name: NF7894_high_41
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_high_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 82 - 220
Target Start/End: Complemental strand, 3807418 - 3807278
Alignment:
| Q |
82 |
accagattggtgctataaaccagaaaaaa-taaatgcaacaagttgaaaccaaagtggatacaggattatgatgc-gacatatgtgcttgttggtgccgt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3807418 |
accagattggtgctataaaccagaaaaaaataaatgcaacaagttgaaaccaaagtggatacaggattatgatgctgacatatgtgcttgttggtgccgt |
3807319 |
T |
 |
| Q |
180 |
gctgaatcggactaaaacacggcgagctaccgtgaaactac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807318 |
gctgaatcggactaaaacacggcgagctaccgtgaaactac |
3807278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University