View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_high_42 (Length: 225)
Name: NF7894_high_42
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 4872009 - 4872221
Alignment:
| Q |
1 |
aacaatagcttatatcaattctgctactcgtgatttcgatgacatgctctctcgcggttactctaccatatccgattatatcgctcttttttcttccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4872009 |
aacaatagcttatatcaattctgctactcgtgatttcgatgacatgctctctcgcggttactctaccatatccgattataacgctcttttttcttccctt |
4872108 |
T |
 |
| Q |
101 |
cttaatatccatcaacacagcactgttcttagacttgctaaacaatttgaatcgcaaaaccctaaccttcatcctgttacaccggacattaatacttggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872109 |
cttaatatccatcaacacagcactgttcttagacttgctaaacaatttgaatcgcaagaccctaaccttcatcctgttacaccggacattaatacttggt |
4872208 |
T |
 |
| Q |
201 |
taatcttcatctc |
213 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
4872209 |
taatcctcatctc |
4872221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University