View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_high_44 (Length: 215)
Name: NF7894_high_44
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 39536559 - 39536742
Alignment:
| Q |
14 |
attctgaaaaagagataccagttgcagggaaggggaaagaagaaagagctgaacgtgcctcactagtaatgaatacaggatcatgatatacctgctgcag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39536559 |
attctgaaaaagagataccagttgcagggaagggaaaagaagaaagagctgaacgtgcctcactagtaatgaatgcaggatcatgatatacctgctgcag |
39536658 |
T |
 |
| Q |
114 |
aaaacggatttgcaccaattcgatgttgatttgcagggcacacatcagatcaatcaagctagtgttagaaggactggttcttta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39536659 |
aaaacggatttgcaccaattcgatgttgatttgcagggcacacatcagatcaatcaagctagtgttagaaggactggttcttta |
39536742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 2462153 - 2462093
Alignment:
| Q |
18 |
tgaaaaagagataccagttgcagggaaggggaaagaagaaagagctgaacgtgcctcacta |
78 |
Q |
| |
|
|||| ||||| |||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
| T |
2462153 |
tgaagaagaggtaccagttgcagggaatggagaagaagaaagagctgaacatgcctcacta |
2462093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 2466217 - 2466149
Alignment:
| Q |
20 |
aaaaagagataccagttgcagggaaggggaaagaagaaagagctgaacgtgcctcactagtaatgaata |
88 |
Q |
| |
|
|||||||| ||||||||||| |||| ||| |||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
2466217 |
aaaaagaggtaccagttgcaaggaatggggaagatgaaagagctgaacgtgcctaactagagatgaata |
2466149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 90
Target Start/End: Original strand, 2626678 - 2626718
Alignment:
| Q |
50 |
aagaagaaagagctgaacgtgcctcactagtaatgaataca |
90 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
2626678 |
aagaagaaagagctgaatgttcctcacaagtaatgaataca |
2626718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University