View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_low_36 (Length: 276)
Name: NF7894_low_36
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 269
Target Start/End: Original strand, 18140476 - 18140730
Alignment:
| Q |
16 |
cacatgttacgtgtggagaaatgagaattgtaagttcaaactcacgccccaacacaacaaatattcaggctatcaattgagtagtacttacaagactatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18140476 |
cacatgttacgtgtggagaaatgagaattgcaagttcaaactcacgccccaacacaacaaatattcaggctatcaattgagtagtacttacaagactatt |
18140575 |
T |
|
| Q |
116 |
tatgtatgtctttacttctcataatttggttactttgtatagcgcacaacaattaacttatacatattcaatttaatttatcagttacaaaattgtgg-n |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18140576 |
tatgtatgtctttacttctcataatttggttactttgtatagcgcacaacaattaacttatacgtattcaatttaatttatcagttacaaaattgtggtt |
18140675 |
T |
|
| Q |
215 |
nnnnnnnnaaatagagaaaataagtaacatccacgtcatatcccgacaacacgaa |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18140676 |
ttttttttaaatagagcaaataagtaacatccacgtcatatccagacaacacgaa |
18140730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University