View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_low_40 (Length: 257)
Name: NF7894_low_40
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 58 - 237
Target Start/End: Original strand, 3080602 - 3080781
Alignment:
| Q |
58 |
cttagaataatggaaaagctatataggtacctgatcaccaattttccacttggagacgtttttgccaacgaattcaatgattccggaacattcaagacct |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3080602 |
cttagaataatggaaaagctatataggtacctgatcaccaattttccacttggagacgtttttgccaacgaattcaataattccggaacattcaagacct |
3080701 |
T |
|
| Q |
158 |
ggataagggctagcaccttgagggggaggataagcgcctttcctctgaagggtatcagctctgttaagggcagtggcgtg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3080702 |
ggataagggctagcaccttgagggggaggataagcgcctttcctctgaagggtatcagctctgttaagggcagtggcgtg |
3080781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 85 - 234
Target Start/End: Original strand, 3067751 - 3067900
Alignment:
| Q |
85 |
tacctgatcaccaattttccacttggagacgtttttgccaacgaattcaatgattccggaacattcaagacctggataagggctagcaccttgaggggga |
184 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| | |||||| || |||| ||||||||||||||||||||||||| ||||| |||||||||||| | |
|
|
| T |
3067751 |
tacctgatcaccaattttccacttggaaacgtttataccaacgcatacaatagttccggaacattcaagacctggataggggcttgcaccttgagggata |
3067850 |
T |
|
| Q |
185 |
ggataagcgcctttcctctgaagggtatcagctctgttaagggcagtggc |
234 |
Q |
| |
|
|| ||| |||||||||||||| ||| || || ||||||||||||||||| |
|
|
| T |
3067851 |
gggtaaaagcctttcctctgaacggtgtcggcactgttaagggcagtggc |
3067900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 85 - 234
Target Start/End: Complemental strand, 18011568 - 18011419
Alignment:
| Q |
85 |
tacctgatcaccaattttccacttggagacgtttttgccaacgaattcaatgattccggaacattcaagacctggataagggctagcaccttgaggggga |
184 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| | |||||| || |||| ||||||||||||||||||||||||| ||||| |||||||||||| | |
|
|
| T |
18011568 |
tacctgatcaccaattttccacttggaaacgtttataccaacgcatacaatagttccggaacattcaagacctggataggggcttgcaccttgagggata |
18011469 |
T |
|
| Q |
185 |
ggataagcgcctttcctctgaagggtatcagctctgttaagggcagtggc |
234 |
Q |
| |
|
|| ||| |||||||||||||| ||| || || ||||||||||||||||| |
|
|
| T |
18011468 |
gggtaaaagcctttcctctgaacggtgtcggcactgttaagggcagtggc |
18011419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University