View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_low_42 (Length: 248)
Name: NF7894_low_42
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 135 - 236
Target Start/End: Complemental strand, 2653987 - 2653886
Alignment:
| Q |
135 |
ctatagttgtgataaccatcatggaggaaaaaatcatagaacacaaaagtgttacaacaaagcttgtaaagtctagtttcatgtcttctctgccaaaaag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653987 |
ctatagttgtgataaccatcatggaggaaaaaatcatagaacacaaaagtgttacaacaaagcttgtaaagtctagtttcatgtcttctctgccaaaaag |
2653888 |
T |
 |
| Q |
235 |
tg |
236 |
Q |
| |
|
|| |
|
|
| T |
2653887 |
tg |
2653886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 2654107 - 2654041
Alignment:
| Q |
19 |
atgtgttgacctgttacaaattttcaaagtctaataaattttccttaaaacttgggattcttgaata |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654107 |
atgtgttgacctgttacaaattttcaaagtctaataaattttccttaaaacttgggattcttgaata |
2654041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University