View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_low_43 (Length: 243)
Name: NF7894_low_43
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 29 - 227
Target Start/End: Original strand, 33317958 - 33318160
Alignment:
| Q |
29 |
aatgaataagagatgc-tgcaaatatgagctcaaatggttaataagttccacc---gataaattgttcagaaaaatttgtgtttgatatttgggtgacat |
124 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||| ||||||||| ||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33317958 |
aatgaataagagatgcgtgcaaatatgagctcaaatagttaatgagttccaccaatgataaattgttcaaaagaatttgtgtttgatatttgggtgacat |
33318057 |
T |
 |
| Q |
125 |
aattcatgnnnnnnnnnnnnnctttgctttgagttactcttaaagttacttgattcatacacttgtggtgaagttagccattttatacgaggaggccaaa |
224 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33318058 |
aattcatgaaaaagaaaaaaactttgctttgagttactcttaaagttacttgattcatacacttgcggtgaagttagccattttatacgaggaggccaaa |
33318157 |
T |
 |
| Q |
225 |
tct |
227 |
Q |
| |
|
||| |
|
|
| T |
33318158 |
tct |
33318160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University