View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_low_44 (Length: 242)
Name: NF7894_low_44
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 229
Target Start/End: Complemental strand, 44211840 - 44211623
Alignment:
| Q |
17 |
ccaacaatttggtatgagcttaggaaagaaatagttatcgaacatgtc-----tatgttcatcttatgaagaaaaataaattataagttatgatttgtaa |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44211840 |
ccaacaatttggtataagcttaggaaagaaatagttatcgaacatatctatgttatgttcatcttatgaagaaaaataaattataagttatgatttgtaa |
44211741 |
T |
 |
| Q |
112 |
aatcgaaatttgatcctgccaaacaaatccaaacttttagttgttgtatgcatcgtataccctggatacgtttactttatggtagaactataatttaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44211740 |
aatcgaaatttgatcctgccaaacaaatccaaacttttagttgttgtatgcatcgtataccctggatacgtttactttatggtagaactataatttaatt |
44211641 |
T |
 |
| Q |
212 |
taattgattggtagtaat |
229 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
44211640 |
taattgattggtaataat |
44211623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University