View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7894_low_52 (Length: 204)
Name: NF7894_low_52
Description: NF7894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7894_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 27066996 - 27066827
Alignment:
| Q |
18 |
caacacactctccacaaagctgccggagttctgctccgccgcccatctcttctgcttcccggaactcacaaaacaacgtcctttcgacccctcacatttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066996 |
caacacactctccacaaagctgccggaattctgctccgccgcccatctcttctgcttcccggaactcacaaaacaacgtcctttcgacccctcacatttc |
27066897 |
T |
 |
| Q |
118 |
actgtctacgaaactgaccagaatttcaccttctacagcctcggagagaatttcaccacctatggaactc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066896 |
actgtctacgaaactgaccagaatttcaccttctacagcctcggagagaatttcaccacctatggaactc |
27066827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 27053807 - 27053747
Alignment:
| Q |
18 |
caacacactctccacaaagctgccggagttctgctccgccgcccatctcttctgcttcccg |
78 |
Q |
| |
|
||||||| | ||||||||| ||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
27053807 |
caacacattatccacaaagttgccggaattctgctctgccgcacatctcttctgcttcccg |
27053747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 27080680 - 27080633
Alignment:
| Q |
18 |
caacacactctccacaaagctgccggagttctgctccgccgcccatct |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || |||||||| |
|
|
| T |
27080680 |
caacacactctccacaaagttgccggagttctgctcggctgcccatct |
27080633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University