View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7895_low_3 (Length: 278)
Name: NF7895_low_3
Description: NF7895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7895_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 43432752 - 43432503
Alignment:
| Q |
17 |
aatattaaataaacaccataaccatcccttatgatcagtcctttcagagctaagctaata--ctaatttattcatataattaatgttatgtttgtttctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43432752 |
aatattaaataaacaccataaccatcccttatgatcagtcctttcagagctaagctaatatactaatttattcatataattaatgttatgtttgtttctt |
43432653 |
T |
 |
| Q |
115 |
ctttcttaaaaatttcattctaattttaatttattgtgttcatttgctgtcnnnnnnngttccactgcctgggttacaactctgattgagttggcaacaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43432652 |
ctttcttaaaaatttcattctaattttaatttattgtgttcatttgctgtctttttttgttccactgcctgggttacaactctgattgagttggcaacaa |
43432553 |
T |
 |
| Q |
215 |
tttagtcctctaatctgtcattagatttagataattatacatgttattgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43432552 |
tttagtcctctaatctgtcattagatttagataattatacatgttattgt |
43432503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University