View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7896_low_7 (Length: 386)
Name: NF7896_low_7
Description: NF7896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7896_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 8 - 369
Target Start/End: Complemental strand, 4753119 - 4752763
Alignment:
| Q |
8 |
tggtgttggagtctgaccattggacagttttagtgtagacacactcagtcatcactgaacagaagtcaagtaaagtgtaaaatacaagctaagattacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4753119 |
tggtgttggagtctgaccattggacagttttagtgtagacacactcagtcatcactgaacagaagtcaagtaaagtgtaaaatacaag-----attacat |
4753025 |
T |
 |
| Q |
108 |
ctcaaatttgcgaacatggtagacacattcacattattgggccccactttcagttacactcctttacccctcacaatcacatttccaacttccaacagaa |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4753024 |
ctcaaatttgcgaacatggttgacacattcacattattgggccccactttcagttacactcctttacccctcacaatcacatttccaacttccaacagaa |
4752925 |
T |
 |
| Q |
208 |
tcttccattcttcttcaacaatggcttcctttccaattccatcttctcccaatcgcaatcaccgtcgctgttactctaaccctaatcactctcaccctcc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4752924 |
tcttccattcttcttcaacaatggcttccattccaattccatcttctcccaatcgcaatcaccgtcgctgttactctaaccctaatcactctcaccctcc |
4752825 |
T |
 |
| Q |
308 |
tcatccacagcctgctctactcgtcttctccggtggaaccgccttcaacggcgtcgttgaag |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4752824 |
tcatccacagcctgctctactcgtcttctccggtggaaccgccttcaacggcgtcgttgaag |
4752763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University