View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7898_high_12 (Length: 213)

Name: NF7898_high_12
Description: NF7898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7898_high_12
NF7898_high_12
[»] chr3 (1 HSPs)
chr3 (16-208)||(31296881-31297073)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 31297073 - 31296881
Alignment:
16 attggaagaactcaaacccnnnnnnntaggttgattaccccaaatcttaaacaaatcaatattatgtgaaacaattggtttctcagatttagcttcattc 115  Q
    |||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31297073 attggaagaactcaaacccaaaaaaataggttgattaccccaaatcttaaacaaatcaatattatgtgaaacaattggtttctcagatttagcttcattc 31296974  T
116 aatttgcttaacctaacttccaatctatgtaatccattatcataatcaacccaagatttcaacttttcaccactattcaacaccaaactcgat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||    
31296973 aatttgcttaacctaacttccaatctatgtaatccattatcataatcaacccaagatttcaacttttcaccactattcaaaaccaaattcgat 31296881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University