View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7898_low_13 (Length: 213)
Name: NF7898_low_13
Description: NF7898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7898_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 31297073 - 31296881
Alignment:
| Q |
16 |
attggaagaactcaaacccnnnnnnntaggttgattaccccaaatcttaaacaaatcaatattatgtgaaacaattggtttctcagatttagcttcattc |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31297073 |
attggaagaactcaaacccaaaaaaataggttgattaccccaaatcttaaacaaatcaatattatgtgaaacaattggtttctcagatttagcttcattc |
31296974 |
T |
 |
| Q |
116 |
aatttgcttaacctaacttccaatctatgtaatccattatcataatcaacccaagatttcaacttttcaccactattcaacaccaaactcgat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
31296973 |
aatttgcttaacctaacttccaatctatgtaatccattatcataatcaacccaagatttcaacttttcaccactattcaaaaccaaattcgat |
31296881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University