View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7899_high_11 (Length: 322)

Name: NF7899_high_11
Description: NF7899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7899_high_11
NF7899_high_11
[»] scaffold0018 (2 HSPs)
scaffold0018 (120-302)||(172846-173030)
scaffold0018 (14-56)||(172742-172784)
[»] scaffold0202 (2 HSPs)
scaffold0202 (163-296)||(18856-18990)
scaffold0202 (156-224)||(18776-18842)
[»] chr6 (1 HSPs)
chr6 (163-304)||(31044406-31044547)


Alignment Details
Target: scaffold0018 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 120 - 302
Target Start/End: Original strand, 172846 - 173030
Alignment:
120 aaagataatggatagttaaacaatttcgattagacc---ttttttatgaatcttggcatattatgaatcg-agagtcaaaaggattaacttggataacat 215  Q
    |||||||||||||| ||||||||||||  |||||||   ||||||||| || |||||||||||||  | | ||||||||||||||||||| | ||||| |    
172846 aaagataatggata-ttaaacaatttcagttagacccttttttttatggattttggcatattatgtgttggagagtcaaaaggattaactag-ataacct 172943  T
216 cattgaaattgaatttttacttctgttttcgtcttgatgcgcccgtattgaattttggcatccgattcagaagcttgccaagcgttt 302  Q
    |||||||||||||||| |||||||||||| |||||| |||  ||||||||||||||||||||||||| ||||| |||||||||||||    
172944 cattgaaattgaatttgtacttctgtttttgtcttgttgcatccgtattgaattttggcatccgattaagaagtttgccaagcgttt 173030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 172742 - 172784
Alignment:
14 atatcaagcattttacgacattttatcctatgtccatatagat 56  Q
    |||||||||||||| |||||||||| |||||||||||||||||    
172742 atatcaagcatttttcgacattttagcctatgtccatatagat 172784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: scaffold0202
Description:

Target: scaffold0202; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 163 - 296
Target Start/End: Original strand, 18856 - 18990
Alignment:
163 tgaatcttggcatattatgaatcg-agagtcaaaaggattaacttggataacatcattgaaattgaatttttacttctgttttcgtcttgatgcgcccgt 261  Q
    ||||| |||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||| ||| || ||    
18856 tgaattttggcatattatgaataggagagtcaaaaggattaact-ggataacatcattgaaattgaatttttatttctgtttttgtcttgctgcacctgt 18954  T
262 attgaattt-tggcatccgattcagaagcttgccaa 296  Q
    ||||||||| |||||||||||| ||||| |||||||    
18955 attgaatttatggcatccgattaagaagtttgccaa 18990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 224
Target Start/End: Original strand, 18776 - 18842
Alignment:
156 ttttttatgaatcttggcatattatgaatcgagagtcaaaaggattaacttggataacatcattgaaat 224  Q
    |||||||||||| ||||||| |||||||   |||||||||||||||||| | |||||||||||||||||    
18776 ttttttatgaattttggcattttatgaa-gtagagtcaaaaggattaac-tagataacatcattgaaat 18842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 163 - 304
Target Start/End: Complemental strand, 31044547 - 31044406
Alignment:
163 tgaatcttggcatattatgaatcg-agagtcaaaaggattaacttggataacatcattgaaattgaatttttacttctgttttcgtcttgatgcgcccgt 261  Q
    ||||| ||||||||||||| || | |||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||| |||||| |  | ||||    
31044547 tgaattttggcatattatgcattggagagtcaaaaggataaact-ggataacatcattgaaattggatttttacttctgttttggtcttgctatggccgt 31044449  T
262 attgaattttggcatccgattcagaagcttgccaagcgtttct 304  Q
    ||||||||||||  || ||||||||||||||||||| ||||||    
31044448 attgaattttggattctgattcagaagcttgccaagtgtttct 31044406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University