View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7899_high_18 (Length: 233)
Name: NF7899_high_18
Description: NF7899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7899_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 41 - 217
Target Start/End: Original strand, 53551532 - 53551708
Alignment:
| Q |
41 |
gaataagcttgcaataattcttagaagcacagatgtctgtctcgtggacttatgcactgcactataatttttgagtggaaataagatgttaagattttct |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53551532 |
gaataagcttgcaataattcttagaagcacatatgtctgtctcgtggacttatgcaatgcactataatttttgagtggaaataagatgttaagattttct |
53551631 |
T |
 |
| Q |
141 |
tttggataagaataagaaatttttaagattatagtagcgtcaaataatagcatgcatgtcacccattagacaattat |
217 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53551632 |
tttggacaagaataagaactttttaaaattatagtagcgtcaaataatagcatgcatgtcacccattagacaattat |
53551708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University