View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7899_low_11 (Length: 322)
Name: NF7899_low_11
Description: NF7899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7899_low_11 |
 | |
|
| [»] scaffold0018 (2 HSPs) |
| | |
|
| [»] scaffold0202 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 120 - 302
Target Start/End: Original strand, 172846 - 173030
Alignment:
| Q |
120 |
aaagataatggatagttaaacaatttcgattagacc---ttttttatgaatcttggcatattatgaatcg-agagtcaaaaggattaacttggataacat |
215 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||||| || ||||||||||||| | | ||||||||||||||||||| | ||||| | |
|
|
| T |
172846 |
aaagataatggata-ttaaacaatttcagttagacccttttttttatggattttggcatattatgtgttggagagtcaaaaggattaactag-ataacct |
172943 |
T |
|
| Q |
216 |
cattgaaattgaatttttacttctgttttcgtcttgatgcgcccgtattgaattttggcatccgattcagaagcttgccaagcgttt |
302 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| ||| ||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
172944 |
cattgaaattgaatttgtacttctgtttttgtcttgttgcatccgtattgaattttggcatccgattaagaagtttgccaagcgttt |
173030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 172742 - 172784
Alignment:
| Q |
14 |
atatcaagcattttacgacattttatcctatgtccatatagat |
56 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
172742 |
atatcaagcatttttcgacattttagcctatgtccatatagat |
172784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 163 - 296
Target Start/End: Original strand, 18856 - 18990
Alignment:
| Q |
163 |
tgaatcttggcatattatgaatcg-agagtcaaaaggattaacttggataacatcattgaaattgaatttttacttctgttttcgtcttgatgcgcccgt |
261 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||| ||| || || |
|
|
| T |
18856 |
tgaattttggcatattatgaataggagagtcaaaaggattaact-ggataacatcattgaaattgaatttttatttctgtttttgtcttgctgcacctgt |
18954 |
T |
|
| Q |
262 |
attgaattt-tggcatccgattcagaagcttgccaa |
296 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
18955 |
attgaatttatggcatccgattaagaagtttgccaa |
18990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 224
Target Start/End: Original strand, 18776 - 18842
Alignment:
| Q |
156 |
ttttttatgaatcttggcatattatgaatcgagagtcaaaaggattaacttggataacatcattgaaat |
224 |
Q |
| |
|
|||||||||||| ||||||| ||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
18776 |
ttttttatgaattttggcattttatgaa-gtagagtcaaaaggattaac-tagataacatcattgaaat |
18842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 163 - 304
Target Start/End: Complemental strand, 31044547 - 31044406
Alignment:
| Q |
163 |
tgaatcttggcatattatgaatcg-agagtcaaaaggattaacttggataacatcattgaaattgaatttttacttctgttttcgtcttgatgcgcccgt |
261 |
Q |
| |
|
||||| ||||||||||||| || | |||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||| |||||| | | |||| |
|
|
| T |
31044547 |
tgaattttggcatattatgcattggagagtcaaaaggataaact-ggataacatcattgaaattggatttttacttctgttttggtcttgctatggccgt |
31044449 |
T |
|
| Q |
262 |
attgaattttggcatccgattcagaagcttgccaagcgtttct |
304 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||| |
|
|
| T |
31044448 |
attgaattttggattctgattcagaagcttgccaagtgtttct |
31044406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University