View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7899_low_12 (Length: 293)
Name: NF7899_low_12
Description: NF7899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7899_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 114 - 277
Target Start/End: Original strand, 9551251 - 9551414
Alignment:
| Q |
114 |
aatttaaccccaaattaactcacacataatcaaatataattccaaatggtaaatgtgtcccctttcaaaatcaaaatccaaaattgattaaactaacaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9551251 |
aatttaaccccaaattaactcacacaacatcaaatataattccaaatggtaaatgtgtcccctttcaaaatcaaaatccaaaattgattaaactaacaca |
9551350 |
T |
|
| Q |
214 |
ttgattaaacacaccaaatatataaaaatgtcccctttaaaaatccaatcaaaatttgttcaaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9551351 |
ttgattaaacacaccaaatatataaaaatgtcccctttaaaaatccaatcaaaatttgttcaaa |
9551414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 25 - 77
Target Start/End: Original strand, 9551161 - 9551213
Alignment:
| Q |
25 |
aacacccaaaataatcaattcaaacttaaaacacggcgtcattcctttcttag |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9551161 |
aacacccaaaataatcaattcaaacttaaaacacggcgtcattcctttcttag |
9551213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University