View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7899_low_15 (Length: 248)

Name: NF7899_low_15
Description: NF7899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7899_low_15
NF7899_low_15
[»] chr7 (1 HSPs)
chr7 (1-232)||(26742667-26742898)


Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 26742898 - 26742667
Alignment:
1 ttatcgagttaatacaaatttgtataaattttagtaatgatgggtaccccctcctcattgcatcgattgcagctgcaacccgcaatccaatggctgatca 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26742898 ttattgagttaatacaaatttgtataaattttagtaatgatgggtaccccctcctcattgcatcgattgcagctgcaacccgcaatccaatggctgatca 26742799  T
101 catagcgacgggacaacaacttgctaacaaagctgagaaaaagctcttctgctgttgcgccttgtttggctccaattatgaagatgctgctgaacttttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26742798 catagcgacgggacaacaacttgctaacaaagctgagaaaaagctcttctgctgttgcgccttgtttggctccaattatgaagatgctgctgaacttttc 26742699  T
201 ctcaaatctgctaaatcattcaaacttggaaa 232  Q
    ||||||||||||||||||||||||||||||||    
26742698 ctcaaatctgctaaatcattcaaacttggaaa 26742667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University