View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7899_low_20 (Length: 214)
Name: NF7899_low_20
Description: NF7899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7899_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 3647544 - 3647420
Alignment:
| Q |
18 |
atgaaattatggaactattatatggcatatacttgcatttgggacaagcccttgaaagaa-tgagttccttgcttcaaaaagaaagcatacaaaactttg |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
3647544 |
atgaaattatggagctattatatggcatatacttgcatttgggacaagcacttgaaagaattgagttccttgcttcaaaaagaaatcttggaaaactttg |
3647445 |
T |
 |
| Q |
117 |
catcaatatacaccaaacagaaagg |
141 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
3647444 |
catgaatatacaccaaacagaaagg |
3647420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University