View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7900_low_3 (Length: 238)
Name: NF7900_low_3
Description: NF7900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7900_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 50 - 223
Target Start/End: Original strand, 14656473 - 14656643
Alignment:
| Q |
50 |
atacctacggttctttataggactactcttcttcttattggttttattgtcagagaagtcaaaaacggggttactattaatagtcctaactgagaacggg |
149 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14656473 |
atacctacggttctttttaggactactcttcttcttattggttttattgtcagagaagtcaaaaacagggttactattaatagtcctaactgagaacggg |
14656572 |
T |
|
| Q |
150 |
ccttacaatgaggtactaagtcctattatcaaaagaatgtaagggatcattcttagttacttgtatgcataatt |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14656573 |
ccttacaatgagg---taagtcctattatcaaaagaatgtaagggatcattcttagttacttgtatgcataatt |
14656643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 14655789 - 14655829
Alignment:
| Q |
12 |
gaagaatataatgtttagactaatttatatagagggggata |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14655789 |
gaagaaaataatgtttagactaatttatatagagggggata |
14655829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University