View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7901_high_16 (Length: 208)
Name: NF7901_high_16
Description: NF7901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7901_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 23 - 198
Target Start/End: Complemental strand, 3253704 - 3253529
Alignment:
| Q |
23 |
agcttcaattaacttggctataacgaagagacacgtttagggttctatcatcacttggctattgatttggattttacaacactcatcgcttcaattcact |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3253704 |
agcttcaattcacttggctataacgaagagacacgtttagggttctatcatcacttggctattgatttggattttacaacactcatcgcttcaattcact |
3253605 |
T |
 |
| Q |
123 |
aattgtgcattgtcctttaagtctttctttgacttctaatggtaactcatcatcaccaccttcttttcatctcact |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3253604 |
aattgtgcattgtcctttaagtctttctttgacttctaatggtaactcatcatcaccaccttcttttcatgtcact |
3253529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University