View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7901_low_12 (Length: 349)
Name: NF7901_low_12
Description: NF7901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7901_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 6 - 334
Target Start/End: Original strand, 6608485 - 6608818
Alignment:
| Q |
6 |
gtcgaagaatatgccaacgggttttgttcatcatcaaacttcaccgtctcagattgggataagaactgtggatgtggataacacttgtaacttctccacc |
105 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6608485 |
gtcgaagaaaaggccaatgggttttgttcatcatcaaacttcaccgtctcagattgggataagaaccgtggatgtggataacacttgtaacttctccacc |
6608584 |
T |
|
| Q |
106 |
acttcaaatctatccatctccatagttacttggaatatgaatggtcaggtactagagtcacttgactactccctccgtttctttttaactgtcgta---- |
201 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6608585 |
acttcaaatctatgcatctccatatttacttggaatatgaatggtcaggtactagagtcacttgactactccctccgtttctttttaactgtcgtatttg |
6608684 |
T |
|
| Q |
202 |
-tttgctgacaaaattttatttctatttagttgttgttttaaagtttaattcaacattattatttaatttggcatgaattaatcaggtttcgtttgaaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6608685 |
ctttgctgacaaaattttatttctatttagttgttgtttcaaagtttaattcaacattattatttaatttggcgtgaattaatcaggtttcgtttgaaga |
6608784 |
T |
|
| Q |
301 |
tttagcagaaatggttagtagcaaccgagatttc |
334 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
6608785 |
tttagcagaaatggttggtagcaaccgagatttc |
6608818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University