View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7901_low_14 (Length: 299)
Name: NF7901_low_14
Description: NF7901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7901_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 27 - 278
Target Start/End: Original strand, 38423307 - 38423554
Alignment:
| Q |
27 |
gtttggtggtttgaacttgatggagaagttttaaacattgaagtagtgggattgattggaatnnnnnnnnnnnnnntcaagtcgtgcgtgacgtgagttg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
38423307 |
gtttggtggtttgaacttgatggagaagttttaaacattgaagtagtgggattgattgggatagagagagag----tcaagtcgtgcgtgacgtgagttg |
38423402 |
T |
 |
| Q |
127 |
agtatacgcgtcttatgaaatgggaaatttagtagtatgtgccaactggatggatttcagtatctactcgtgtctggtaagtaagaccccttcgttctag |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38423403 |
agtatacgcgtcttatgaaatgggaaatttagtagtatgtgccaactggatggatttcagtatctactcgtgtctggtaagtaagaccccttccttctag |
38423502 |
T |
 |
| Q |
227 |
ttttctataaattcnnnnnnntgctaataagtgttgtgtattgatcaagatg |
278 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
38423503 |
ttttctataaattcaaaaaaatgctaataattgttgtgtattgatcaagatg |
38423554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University