View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7901_low_16 (Length: 286)
Name: NF7901_low_16
Description: NF7901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7901_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 60 - 178
Target Start/End: Original strand, 2173775 - 2173896
Alignment:
| Q |
60 |
tccgattttggggagtggg-cagatggtaagtggttgtagtggagtaaatggaggctgccattct--gtttgggaggaagagttttgcaagaagctggtg |
156 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2173775 |
tccgattttggggagtggggcagatggtaagtggttgtggcggagtaaatggaggctgccattctttgtttgggaggaagagttttgcaagaagctggtg |
2173874 |
T |
|
| Q |
157 |
gagttggtctcttcgtttggta |
178 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2173875 |
gagttggtctcttcgtttggta |
2173896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 234 - 280
Target Start/End: Original strand, 2173890 - 2173936
Alignment:
| Q |
234 |
tttggtaaaatcaatctacattcatctttgtaggaacttcttctctc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2173890 |
tttggtaaaatcaatctacattcatctttgtaggaacttcttctctc |
2173936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 2173709 - 2173751
Alignment:
| Q |
18 |
aatttacatcttaagcaaggcttcccaagattttattagttgt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2173709 |
aatttacatcttaagcaaggcttcccaagattttattagttgt |
2173751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University