View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7902_low_10 (Length: 235)
Name: NF7902_low_10
Description: NF7902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7902_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 49484177 - 49484382
Alignment:
| Q |
16 |
agatcaacatctgacatttgtgtgttcttgtgcttcttgcagtattcaatgaccttggtcaacaattcgctattcactaaagaaagagaaatgctattga |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||| | || |||| ||||||||||||||||||| | ||| | |
|
|
| T |
49484177 |
agatcaacatctgacatttgtgcgttcttgtgcttcttgcagtattcaatgaccatggccaatattttgctactcactaaagaaagagaaatacaattaa |
49484276 |
T |
|
| Q |
116 |
tatcaccagcaggattgatctccatagcatcctggattgtttttgacataagtgcaacatcgtaatcaacttcaaacacatccccatccgagcttatcaa |
215 |
Q |
| |
|
|||||||| ||||| |||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49484277 |
catcaccagtaggatctgtctcaatagcatcctcaattgtttttgacataagtgcaacatcgtagtcaacttcaaacatatccccatccgagcttatcaa |
49484376 |
T |
|
| Q |
216 |
gttgat |
221 |
Q |
| |
|
|||||| |
|
|
| T |
49484377 |
gttgat |
49484382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 220
Target Start/End: Complemental strand, 55072131 - 55072066
Alignment:
| Q |
155 |
tttttgacataagtgcaacatcgtaatcaacttcaaacacatccccatccgagcttatcaagttga |
220 |
Q |
| |
|
|||||||||||||||| | | | ||||||||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
55072131 |
tttttgacataagtgccaaacccaaatcaacttcaaacacaaccccgtccgagcttaccaagttga |
55072066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 55072247 - 55072199
Alignment:
| Q |
45 |
gtgcttcttgcagtattcaatgaccttggtcaacaattcgctattcact |
93 |
Q |
| |
|
|||||||||||||||||||| |||| || |||||| || |||||||||| |
|
|
| T |
55072247 |
gtgcttcttgcagtattcaacgaccatgctcaacattttgctattcact |
55072199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University