View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7902_low_11 (Length: 228)

Name: NF7902_low_11
Description: NF7902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7902_low_11
NF7902_low_11
[»] chr4 (1 HSPs)
chr4 (161-206)||(19326290-19326336)


Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 206
Target Start/End: Original strand, 19326290 - 19326336
Alignment:
161 tggttttataaa-aaacatgacctaaatatttgtgtgtgacactctt 206  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||    
19326290 tggttttataaagaaacatgacctaaatatttgtgtgtgacactctt 19326336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University