View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7902_low_12 (Length: 226)
Name: NF7902_low_12
Description: NF7902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7902_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 39586702 - 39586510
Alignment:
| Q |
15 |
gaagaagaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggttcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39586702 |
gaagaagaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggtttg |
39586603 |
T |
 |
| Q |
115 |
attttggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcagggtttgattgatgagcataggaggaagaagg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39586602 |
attttggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcaaggtttgattgatgagcataggaggaagaagg |
39586510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University