View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7902_low_6 (Length: 331)
Name: NF7902_low_6
Description: NF7902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7902_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 4328812 - 4328514
Alignment:
| Q |
16 |
attcgtagtaaaatatggagggagtatttttgttggtggtcatttagcatagaaaatggcaatcacatgcgatttgaattaaacatgtttataattcatt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328812 |
attcgtagtaaaatacggagggagtatttttgttggtggtcatttagcatagaaaatggcaatcacatgcgatttgaattaaacatgtttataattcatt |
4328713 |
T |
 |
| Q |
116 |
ttcggcatagaatttcatgaaatttggcaaaagcatgtgctgtgtggtttacgtatttcaggaatgctatactgcttttgctaaacctaagccaaaatgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328712 |
ttcggcatagaatttcatgaaatttggcaaaagcatgtgttgtgtggtttacgtatttcaggaatgctatactgcttttgctaaacctaagccaaaatgc |
4328613 |
T |
 |
| Q |
216 |
tcatgagcatttattgtaaccaataacactccttggattacaacacaatgttgtaacttatatggaaagtatttttggactttgcgaaatgcatgatga |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328612 |
tcatgagcatttattgtaaccaataacactccttggattacaacacaatgttgtaacttatatggaaagtatttttggactttgcgaaatgcatgatga |
4328514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University