View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7902_low_8 (Length: 262)
Name: NF7902_low_8
Description: NF7902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7902_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 53 - 245
Target Start/End: Complemental strand, 48685309 - 48685117
Alignment:
| Q |
53 |
catagtactaaaattgaaaagtaaagagaaagaacatgcaaaaagtcccttgttacgtacattaattaattcatgtatgtatgttcaatttgctaattga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48685309 |
catagtactaaaattgaaaagtaaagagaaagaacatgcaaaaagtcccttgttacgtacattaattaattcatgtatgtatgttcaatttgctaattga |
48685210 |
T |
 |
| Q |
153 |
ccaaactggtggcttgtcgtatgaagaaaggaaaaatgacataggatgagctcatgcatgcatgttactggaaaaggtatacagtgttaatat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
48685209 |
ccaaactggtggcttgtcgtatgaagaaaggaaaaatgacttaggatgagctcatgcatgcatgttactggaaaatgtatacagtattaatat |
48685117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University