View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7903_low_2 (Length: 477)
Name: NF7903_low_2
Description: NF7903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7903_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 28188124 - 28188305
Alignment:
| Q |
14 |
atattattctgtttgtaccttcttgagatgtcacctttgtgcttgtgtggacacaaaacacaaaaccaaaccaaacttaagtggtagttggccacaagaa |
113 |
Q |
| |
|
|||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188124 |
atattattttcttggtaccttcttgagatgtcacctttgtgcttgtgtggacacaaaacacaaaaccaaaccaaacttaagtggtagttggccacaagaa |
28188223 |
T |
|
| Q |
114 |
gtggaaatgaattgcaaaatgtggaatacaaggtttacacaatcaaacaccaactacaatcggcaagtggactgaccgaccc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28188224 |
gtggaaatgaattgcaaaatgtggaatacaaggtttacacaatcaaacaccaactacaattggcaagtggactgaccgaccc |
28188305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 345 - 408
Target Start/End: Original strand, 28188404 - 28188467
Alignment:
| Q |
345 |
ctagagttagagcatctccaatgataatatttttaagtgcgtcaaatcaaatttatgatactcg |
408 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188404 |
ctagagttagagcatctccaatggtaatatttttaagtgcgtcaaatcaaatttatgatactcg |
28188467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 217 - 266
Target Start/End: Original strand, 28188327 - 28188376
Alignment:
| Q |
217 |
atatcactggtgtttttaaggaatcatcgtaatcattaagctaaaattaa |
266 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
28188327 |
atatcactagtgtttttaaagaatcatcataatcataaagctaaaattaa |
28188376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University