View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7903_low_3 (Length: 333)
Name: NF7903_low_3
Description: NF7903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7903_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 27 - 316
Target Start/End: Complemental strand, 27923329 - 27923040
Alignment:
| Q |
27 |
tagataatacttagcttacaagagttttgaggcattcaaatgtaatttcaaatttggagagttccagtgcccattttgtcattttctaggcaaaatctgg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27923329 |
tagataatacttagcttacaagagttttgaggcattcaaatgtaatttcgaatttggagagttccagtgcccattttgtcatttgctaggcaaaatctgg |
27923230 |
T |
 |
| Q |
127 |
tatgaataacatgtgtttaatgggttggttaatccacaccacagtagggtaggccatgaagtctcgacaaagctttctcgtaggtgtcatcagggctaag |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27923229 |
tatgaacaacatgtgtttaatgggttggttaatccacaccacagtagggtaggccatgaagtctcgacaaagctttcttgtaggtatcatcagggctaag |
27923130 |
T |
 |
| Q |
227 |
gcaaccttttcgattttttgtcttacctcggtccctttgagtactttgttcataaagtatacctagtgttgggtttcatcgtccttcctg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27923129 |
gcaaccttttcgattttttgtcttacctcggtccctttgagtactttgttcataaagtatacctagtgttgggtttcatcgtcctccctg |
27923040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University