View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7903_low_5 (Length: 255)
Name: NF7903_low_5
Description: NF7903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7903_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 11384783 - 11384705
Alignment:
| Q |
157 |
aagttaatggttaattctagttcttgttaaacatagaatg-aatagtttgtaaacttgatatgttaaagtgaataactaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11384783 |
aagttaatggttaattctagttcttgttaaaca-ataatgcaatagtttgtaaacttgatatgttaaagtgaataactaa |
11384705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 90
Target Start/End: Original strand, 28020549 - 28020591
Alignment:
| Q |
47 |
ttgtttggatattttaagtcaaaattgcttttgggtgtataaat |
90 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
28020549 |
ttgtttggatattttaagtc-aaattgcttttgggtttataaat |
28020591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University