View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7904_low_12 (Length: 290)
Name: NF7904_low_12
Description: NF7904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7904_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 1573066 - 1572794
Alignment:
| Q |
1 |
gcggaaatcctttgaaccaatgtcaggtgggggctccaagattgggttatttgcatatttaatccaatcaaggagaagggggtcagataagttggccgga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573066 |
gcggaaatcctttgaaccaatgccaggtgggggctctaagattgggttatttgcatatttaacccaatcaaggagaagggggtcagataagttggccgga |
1572967 |
T |
|
| Q |
101 |
tgagcaagattttgcacttgcacatagttgtctgtatcgcctgtataaagcattatgatttcgccatctggcaaaagcgtggcggatccggtccatacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1572966 |
tgagcaagattttgcacttgcacatagttgtctgtatcgcctgtgtaaagcattatgacttcgccatctggcaaaagcgtggcggatccggtccatacac |
1572867 |
T |
|
| Q |
201 |
cgttaatatcgaaccatttgtcgggttccatggcaatgggaaggtaaagccaatgaatcatgtccgttgatac |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1572866 |
cgttaatatcgaaccatttgtcgggttccatggcaatgggaaggtaaagccaatgaatcatgtccgatgatac |
1572794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University