View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7904_low_5 (Length: 489)
Name: NF7904_low_5
Description: NF7904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7904_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 5e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 337 - 472
Target Start/End: Original strand, 35769345 - 35769480
Alignment:
| Q |
337 |
ttatcttgctacgggtgtggccttgtgtccacttatcgtgtcttttgtggccatgtgttaactttagtgtcnnnnnnnagaggcgccaatcatatgtcta |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35769345 |
ttatcttgctacgggtgtggccttgtgtccacttatcgtgtcttttgttaccatgtgttaactttagtgtctttttttagaggcgccaatcatatgtcta |
35769444 |
T |
 |
| Q |
437 |
gacacgtacaacgcatgcttacttgcttattagaat |
472 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35769445 |
gacacgtacaacgcatgctttcttgcttattagaat |
35769480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University