View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7906_high_13 (Length: 338)
Name: NF7906_high_13
Description: NF7906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7906_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 327
Target Start/End: Original strand, 6101123 - 6101455
Alignment:
| Q |
17 |
agatatggcgtcgttttcgaacaaaacggagatcgtgattgttcactgttgagacatatgaatgaacagaatcagatgaannnnnnnnnnnnn----agg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6101123 |
agatatagcgtcgttttcgaacaaaacggagatcgtgattgttcactgttgagacatatgaatgaacagaatcagatgaaagagagagagagagagaagg |
6101222 |
T |
|
| Q |
113 |
tgaatctctgtctttgagtctgatcagtgtgtgaagcttttattgtagttgagttatgggtcaaacacaaacttacaaattactaagaccagtcatatat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6101223 |
tgaatctctgtctttgagtctgatcagtttgtgaagcttttattgtagttgagttatgggtcaaacacaaacttacaaattactaagaccagtcatatat |
6101322 |
T |
|
| Q |
213 |
tgtacgtatatactgctttaactgcctctaacattattcattcata------------------tgctatttctatagtatattcacgaccctcacaact |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6101323 |
tgtacgtatatactgctttaactgcctctaacattattcattcatatgctattgctattgctattgctatttctatagtatattcacgacccccacaact |
6101422 |
T |
|
| Q |
295 |
ttcgtccctccccgttaactttgatgcattctt |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6101423 |
ttcgtccctccccgttaactttgatgcattctt |
6101455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University