View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7906_low_21 (Length: 280)
Name: NF7906_low_21
Description: NF7906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7906_low_21 |
 |  |
|
| [»] scaffold0368 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0368 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: scaffold0368
Description:
Target: scaffold0368; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 12174 - 11978
Alignment:
| Q |
15 |
atgaaccctaagcaactgttgttgacattagaaatgcatcgatatacggtttatattaagttatgatgatataatttatttattttttcatcnnnnnnnt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| ||||||||| | |
|
|
| T |
12174 |
atgaaccctaagcaactgttgttgacattagaaatgcatggatatacgg-ttatattaagttgtgatgatataatttattta-tttttcatcaaaaaaat |
12077 |
T |
 |
| Q |
115 |
ttgttgttgccnnnnnnnntctacacaatatttttactaccacgtcttatattttttgacaaaaccatgcgacaactattattttcatttttattctttc |
214 |
Q |
| |
|
||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
12076 |
ttgttgttgccaaaaaaaa-ccacacaatatttttattaccacgtcttatattttttgacaaaaccatgtgacagctattattttcatttttattctttc |
11978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0368; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 257
Target Start/End: Complemental strand, 11965 - 11936
Alignment:
| Q |
228 |
ttagttttgttattttttaatttaacgtta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11965 |
ttagttttgttattttttaatttaacgtta |
11936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 15 - 214
Target Start/End: Original strand, 42838633 - 42838829
Alignment:
| Q |
15 |
atgaaccctaagcaactgttgttgacattagaaatgcatcgatatacggtttatattaagttatgatgatataatttatttattttttcatcnnnnnnnt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| ||||||||| | |
|
|
| T |
42838633 |
atgaaccctaagcaactgttgttgacattagaaatgcatggatatacgg-ttatattaagttgtgatgatataatttattta-tttttcatcaaaaaaat |
42838730 |
T |
 |
| Q |
115 |
ttgttgttgccnnnnnnnntctacacaatatttttactaccacgtcttatattttttgacaaaaccatgcgacaactattattttcatttttattctttc |
214 |
Q |
| |
|
||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
42838731 |
ttgttgttgccaaaaaaaa-ccacacaatatttttattaccacgtcttatattttttgacaaaaccatgtgacagctattattttcatttttattctttc |
42838829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 257
Target Start/End: Original strand, 42838842 - 42838871
Alignment:
| Q |
228 |
ttagttttgttattttttaatttaacgtta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42838842 |
ttagttttgttattttttaatttaacgtta |
42838871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University