View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7906_low_22 (Length: 272)
Name: NF7906_low_22
Description: NF7906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7906_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 8254857 - 8255112
Alignment:
| Q |
1 |
aaacattcttggctcttgctcccctattaatcgacattccaataagaaattttcaacttttttaattacatgatcatgatcatgatcgaatatagaggga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8254857 |
aaacattcttggctcttgctcccctattaatcgacattccaataagaaattttcaacttttttaattacttgat------catgatcgaatatagaggga |
8254950 |
T |
|
| Q |
101 |
aggggaagaaccaaaaaatattgtaacacttttttacaaaactcataaaattaatagttatcccgaaagcattcctattggctaaccacatgtgttttcc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8254951 |
aggggaagaaccaaaaaatactgtaacacttttttacaaaactcataaaattaatagttatcccgaaagcattcctattggctaaccacctgtgttttcc |
8255050 |
T |
|
| Q |
201 |
gcccaattccttttgaaaaccatctcatgtatgttcacacccaactctgagtatgacatatt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255051 |
gcccaattccttttgaaaaccatctcatgtatgttcacacccaactctgagtatgacatatt |
8255112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 246
Target Start/End: Original strand, 45102736 - 45102806
Alignment:
| Q |
176 |
tattggctaaccacatgtgttttccgcccaattccttttgaaaaccatctcatgtatgttcacacccaact |
246 |
Q |
| |
|
|||||| || |||| ||||||||| ||||||||||||||||||| | ||||||||| | |||| |||||| |
|
|
| T |
45102736 |
tattggttacccacctgtgttttctgcccaattccttttgaaaatcgcctcatgtatttccacaaccaact |
45102806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 157 - 259
Target Start/End: Complemental strand, 18962764 - 18962663
Alignment:
| Q |
157 |
gttatcccgaaagcattcctattggctaaccacatgtgttttccgcccaattccttttgaaaaccatctcatgtatgttcacacccaactctgagtatga |
256 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||| |||||||||| ||||| |||| ||||||||| |||||| |||||||| ||| ||| |
|
|
| T |
18962764 |
gttatcccgaatacattcctattggctacccacccgtgttttgtgcccaattcc-tttgataaccgcctcatgtattttcacaaccaactctcagtgtga |
18962666 |
T |
|
| Q |
257 |
cat |
259 |
Q |
| |
|
||| |
|
|
| T |
18962665 |
cat |
18962663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University