View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7907_low_1 (Length: 487)
Name: NF7907_low_1
Description: NF7907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7907_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 11 - 472
Target Start/End: Original strand, 2467627 - 2468074
Alignment:
| Q |
11 |
cagagagcgagctgcgaagcatagcatagcagagttgaagcaacgcagaagaaggaattagaaatgcaatcacactttttctcacattcgctccattcgt |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467627 |
cagagagcgagctgcgaagca-----tagcagagttgaagcaacgcagaagaaggaattagaaatgcaatcacactttttctcacattcgctccattcgt |
2467721 |
T |
|
| Q |
111 |
ttccaaaaccatttaagagccagcacttttcatctttcaccacctcacttatatcctcttccattttcccccctcctactcctcgctgcaatctcaaatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2467722 |
ttccaaaaccatttaagagccagcactttttatctttcaccacctcacttatatcctcttccatttttccccctcctactcctcgctgcaatctcaaatt |
2467821 |
T |
|
| Q |
211 |
accaccacgctttcaattcaccaacatttttcgggctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaattta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467822 |
accaccacgctttcaattcaccaacatttttcggtctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaattta |
2467921 |
T |
|
| Q |
311 |
ttttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttc |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467922 |
ttttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttc |
2468021 |
T |
|
| Q |
411 |
tgatgataatgatgatgcatccatgacagttttgaagtttatgctgttctctgcgttcttcg |
472 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2468022 |
---------tgatgatgcatccatgacagttttgaagtttatgctgttctccgcgttcttcg |
2468074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University