View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7907_low_2 (Length: 437)
Name: NF7907_low_2
Description: NF7907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7907_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 52232747 - 52233042
Alignment:
| Q |
1 |
atgaaacctgaaagagaggtaacgaaatagagagcaccgtggagaccaccgatggcgaggcgaccgaaaccctcagcacgaccggcaatggacctcaaat |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52232747 |
atgaaacctgaaagggaggtaacgaaatagagaccaccgtggagaccaccgatggcgaggcgaccgaaaccctcagcacgaccggcaatggacctcaaat |
52232846 |
T |
|
| Q |
101 |
tggaatctgcatctccgtatggctgcatcatcaatcaatcttcttcaatacaagggattcttctttttcaccgattcaa-aattgattatttattttaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
52232847 |
tggaatctgcatctccgtatggctgcatcatcaatcaatcttcttcaatacaagggattcttctttttcaccgattcaataattgattatttattttata |
52232946 |
T |
|
| Q |
200 |
ggttaaattaattaaggagatactaactatttatgtatactaaattgattgcttaaattacacttttacacttcccttcctcttctgtaaaacacgtt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
52232947 |
ggttaaattaattaaggagatactaactatttatg--tactaaattgattgcttaaattacactttaacacttccctttctcttctgtaaaacacgtt |
52233042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University