View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7907_low_6 (Length: 288)
Name: NF7907_low_6
Description: NF7907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7907_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 280
Target Start/End: Original strand, 49105297 - 49105560
Alignment:
| Q |
17 |
agcagttaattgttgtttgtgagaatcatgaggctacagggaagatccctttctatgtgtttaatttacaacaaaattattgtcgtccattgaactgaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49105297 |
agcagttaattgttgtttgtgagaatcatgaggctgcagggaagatccctttctatgtgtttaatttacaacaaaattattgtcgtccattgaactgaag |
49105396 |
T |
 |
| Q |
117 |
aggtaattttggtcactcacatcccatctgtgaccagtcccatataataaaaacaatgatgggtctatttttgatttttgcatagggtggtgctctcatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
49105397 |
aggtaattttggtcactcacatcccatctgtgaccagtccaatataataaaaacaatgatgggtctattttttatttttgcataggttggtgctctcatg |
49105496 |
T |
 |
| Q |
217 |
tatgtgtgccacatgtaacaaaaacaattaagatgatggtcaatgttatgttgttatattcttc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49105497 |
tatgtgtgccacatgtaacaaaaacaattaagatgatggtcaatgttatgttgttattttcttc |
49105560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University