View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7909_high_10 (Length: 316)
Name: NF7909_high_10
Description: NF7909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7909_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 62 - 300
Target Start/End: Original strand, 25303651 - 25303889
Alignment:
| Q |
62 |
aataatgatagaacacaagattaaatccatcagaccttggggacttatcaggttgcatttgaaatagggcatgtttgcgctcttttctagtaatcagtgt |
161 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25303651 |
aataatgatagaacgcaggattaaatccatcagacctcgaggacttatcaggttgcatttgaaatagggcatgtttgagctcttttctagtaatcagtgt |
25303750 |
T |
 |
| Q |
162 |
cataagcatatcattgtattcgtgggtaacccacacactttagaaaatcaagaacatgcgtatggttaccattgttggccgcaaaaaccacatcaaaata |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25303751 |
cataagcatatcattgtattcgtgggtaacccacacactttagaaaatcaagaacatgcgtatggttaccattgttggctgcaaaaaccacatcaaaata |
25303850 |
T |
 |
| Q |
262 |
attctttgctacatcacataggtgctcctatctcataac |
300 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25303851 |
attatttgctacatcacataggtgctcctatctcataac |
25303889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 25302562 - 25302624
Alignment:
| Q |
1 |
atcatccgttttatatcatgaaccatggaattatggaggacatatatactaataatataggaa |
63 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
25302562 |
atcatctgttttatatcatgaccaatggaattatggaggtcatatatactcataatataggaa |
25302624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University