View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7909_high_11 (Length: 303)
Name: NF7909_high_11
Description: NF7909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7909_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 43458769 - 43458606
Alignment:
| Q |
18 |
agccacattaaatatctttgatgtttattcagaagaaaattggtactggataggtgtagcagctcttcttggtttcactgttttctataatgttctattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458769 |
agccacattaaatatctttgatgtttattcagaagaaaattggtactggataggtgtagcagctcttcttggtttcactgttttctataatgttctattc |
43458670 |
T |
|
| Q |
118 |
acccttgcacttatgtacctaaaccgtaagacctcacattatgttcaatatgttaagtaaaatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458669 |
acccttgcacttatgtacctaaaccgtaagacctcacattatgttcaatatgttaagtaaaatc |
43458606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 240 - 303
Target Start/End: Complemental strand, 43458547 - 43458484
Alignment:
| Q |
240 |
attcactagctgttggaaagaaacaagcaattatatcagaagaagaagcaggtgaaatggaaac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43458547 |
attcactagctgttggaaagaaacaagcaattatatcagaagaagaagcaagtgaaatggaaac |
43458484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 157
Target Start/End: Original strand, 4500286 - 4500410
Alignment:
| Q |
33 |
ctttgatgtttattcagaagaaaattggtactggataggtgtagcagctcttcttggtttcactgttttctataatgttctattcacccttgcacttatg |
132 |
Q |
| |
|
||||||||||||| | | ||||||||||| ||||| |||| | ||||||| || ||| | |||||| || |||||||| ||||||||| |||||||| |
|
|
| T |
4500286 |
ctttgatgtttatgctaatgaaaattggtattggattggtgctggagctcttgctgttttaattgttttttacaatgttctcttcacccttacacttatg |
4500385 |
T |
|
| Q |
133 |
tacctaaaccgtaagacctcacatt |
157 |
Q |
| |
|
||||||| ||||||||||| |||| |
|
|
| T |
4500386 |
tacctaagtcgtaagacctcgcatt |
4500410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University