View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7909_low_12 (Length: 355)
Name: NF7909_low_12
Description: NF7909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7909_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 3 - 174
Target Start/End: Original strand, 4236290 - 4236458
Alignment:
| Q |
3 |
attgaagtttagagacaagctggatatttgggacaaactacaaaccattatatattgattattgactattcattggtatgtcggttaaagtttataccat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
4236290 |
attgaagtttagagacaagctggatatttggtacaaactacaaaccattat----tgattattgactattcattcatatgtcggttaaagttcataccat |
4236385 |
T |
 |
| Q |
103 |
gtcaacgttttgcctacaattgagctctttattttttaatgacaaat-ttaaaatgttagtagtatgttaatc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
4236386 |
gtcaacgttttgcctacaattgagctctttattttttaatgacaattgttaaaatgttagtagtatgttaatc |
4236458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 188 - 269
Target Start/End: Original strand, 4236444 - 4236521
Alignment:
| Q |
188 |
agtagtatgttaatctctcccaaaataattaaccttatttgatcacgtgattatacacacacataatatattttaatcatac |
269 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
4236444 |
agtagtatgttaatctctctcaaaataattaaccttatttgatcacgtggttat----acacataatatactttaatcatac |
4236521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University