View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7909_low_20 (Length: 274)
Name: NF7909_low_20
Description: NF7909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7909_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 24 - 253
Target Start/End: Complemental strand, 42514635 - 42514404
Alignment:
| Q |
24 |
ataaaatacgttgtcgattctccccttcctctgaaacacgtggatttctggtgtgtgtcctatccctacaataatcaatacgtagtagatgcaggggcca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42514635 |
ataaaatacgttgtcgattctccccttcctctgaaacacgtggatttctggtgtgtgtcctatccctacaataatcaatacgtagtagatgcaggggcca |
42514536 |
T |
|
| Q |
124 |
ttgcatgtccattattatcacatgccaatgtcaattctggatgtggatcc--atagcatataccttaatgttttatttttgctgaaatctcatgctttta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42514535 |
ttgcatgtccattattatcacatgccaatgtcaattctggatgtggatccatatagcatataccctaatgttttatttttgctgaaatctcatgctttta |
42514436 |
T |
|
| Q |
222 |
ttttgtggtcaacactttcatcccattctcta |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42514435 |
ttttgtggtcaacactttcatcccattctcta |
42514404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University