View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7909_low_27 (Length: 212)
Name: NF7909_low_27
Description: NF7909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7909_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 184
Target Start/End: Complemental strand, 2452215 - 2452050
Alignment:
| Q |
19 |
tgttaacgataaattgttcaagaatattcaagtttggatcctagataaaatatggtctaagacnnnnnnntatacattatcattgcttattagaaattat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2452215 |
tgttaacgataaattgttcaagaatattcaagtttggatcctagataaaatatggtctaagacaaaaaaatatacattatcattgcttattagaaattat |
2452116 |
T |
|
| Q |
119 |
aataataacttttttgagtggaaacaatacaagcaacagcaggccagatattactagttaacggaa |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2452115 |
aataataacttttttgagtggcaacaatacaagcaacagcaggccagatattactagttaacggaa |
2452050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University